| Regulated Operon: | yfhS | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yfhS | - | 936108..936332 | yfhS-BAC | 
| Operon evidence: | Northern blotting (0.3 kb transcript) | 
|---|---|
| Reference: | Yamamoto H, et al. (1999), BSORF | 
| Comments: | The promoter upstream of yfhS may be recognized by SigG instead of SigE. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -38:+11 | 936348..936396 | TAGCGTATAGTTCTTTTATTTCCACAAACAATAATGGCAAGAACTTTAA | Yamamoto H, et al. (1999): PE NB DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AGCAATGAGCTGTTCACGCTCAGTTTTGATCCCTTTTT >>>>> <<<<< | yfhS | 


| 
 |