 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yitE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yitE | - | 1173441..1174070 | COG1284 |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SpoIIID | Negative | ND | ND | ND |
Eichenberger P, et al. (2004): GS AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CATCAGAAAAATCGGCAATGTAAGCCGCTTTCTCTTTATTTGT >>>> <<<< |
yitE |
|