| Regulated Operon: | yjbX | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yjbX | cotO | + | 1247977..1248660 | 
| Operon evidence: | downstream gene is in the opposite direction | 
|---|---|
| Reference: | |
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -39:+10 | 1247921..1247969 | TTTCTTCTGATTTTCAGCTTTCTGTCATATAGATAGAATATGACACAAT | Eichenberger P, et al. (2003): AR, 5'-RACE-PCR Feucht A, et al. (2003): AR DB RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAAGCTGCCCGGCTGATGTTGCCGGACAGCTTTTTTTACATAGAG >>>>>>>>>> <<<<<<<<<< | yjbX | 


| 
 |