| Regulated Operon: | yjfA | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yjfA | - | 1281882..1282355 | 
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand | 
|---|---|
| Reference: | Kuwana R, et al. (2002) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | ND | ND | ND | Kuwana R, et al. (2002): SDS-PAGE, RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TATTAAATAGAAAAAAGGCTGTCCGTACGGACAGCCTTTTCTAATTTATTT >>>>>>>> <<<<<<<< | yjfA | 


| 
 |