| Regulated Operon: | yjoB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yjoB | + | 1313763..1315034 | COG0465 |
| Operon evidence: | primer extension of downstream rapA gene |
|---|---|
| Reference: | Mueller JP, et al. (1992) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigW | Promoter | -39:+4 | 1313695..1313737 | TGGGATGAAACAAAATGCTATGTCAATCGTATATATAACGTTC |
Huang X, et al. (1999): S1 Cao M, et al. (2002): AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGAAAGCACGGGTGTTTGAAAAACCCGTGCTTTTTTGTTGCGGTT >>>>>>>> <<<<<<<< |
yjoB |


|