| Regulated Operon: | yknT | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yknT | cse15 | - | 1493710..1494675 | 
| Operon evidence: | upstream and downstream genes are in the opposite direction | 
|---|---|
| Reference: | Henriques AO, et al. (1997) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -42:+6 | 1494690..1494737 | AGAGGAATAGCTGTTCAGTATTTGCATATTGTAGTGTTAACATCATGA | Henriques AO, et al. (1997): PE HM OV DB RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAACTGCTTGAGCGATGCCAAGCAGTTTTTCTTTATATTT >>>>>>>>>> <<<<<<<<< | yknT | 


| 
 |