| Regulated Operon: | yloB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yloB | + | 1637265..1639937 | COG0474 | yloB-BAC |
| Operon evidence: | Genome analysis; upstream gene is on the opposite strand |
|---|---|
| Reference: | Genbank Y13937 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | ND | ND | ND |
Feucht A, et al. (2003): AR DB RG Raeymaekers L, et al. (2002): Western blotting |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATATAATCTTAGGGGTAATAGCGTGTCTATTGCCCTTTTATTATGAGAAC >>>>>>>>> <<<<<<<<< |
yloB |


|