 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yncD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yncD | - | 1897149..1898333 | COG0787 |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | ND | ND | ND |
Feucht A, et al. (2003): AR DB RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CTTAAAATGCTGAATCAAAATCCCTCTACCAGAGGGATTTTGTTTTTTCTGA >>>>>>> <<<<<<< |
yncD |
|