| Regulated Operon: | yndN | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yndN | fosB | + | 1915872..1916306 | COG0346 | x0903-BAC | 
| Operon evidence: | upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | Cao M, et al. (2001) | 
| Comments: | 
| Binding factor  | 
  Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigW | Promoter | -41:+4 | 1915804..1915848 | CTGTATGAAACTTTCTTATGAAAAAAGTCGTATATGTGGATGATC | 
  Cao M, et al. (2001): PE RG DB OV Cao M, et al. (2002): AR  | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| CTATTCGGGCTCGCACCCAAAAGTCAGGGCGAGCCTGCTTTTTTTGAACAACA >>>>>>>>>>>> <<<<<<<<<<<  | 
  yndN | 


  |