| Regulated Operon: | ypuBC | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ypuB | - | 2433336..2433539 | ||||
| ypuC | - | 2432969..2433358 | 
| Operon evidence: | Genome analysis | 
|---|---|
| Reference: | Petersohn A, et al. (1999), Azevedo V, et al. (1993) | 
| Comments: | In a Northern blotting experiment, Azevedo found a 1.2 kb transcript covering ypuB and ypuC, but starting far upstream of ypuB. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | ND | 2433561..2433602 | TGCTGATTATACAAAAAGTGGATTGGGAATGATAAAAGAACA | Petersohn A, et al. (1999): HB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CGAGTGATGTTGCTGCGGGTTACGCCTTCGGCGGTGTTTGGCTGAGTTTGAATGTTTTGGT >>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<< | ypuC | 


| 
 |