 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ypuE-ribDEAHT |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ypuE | - | 2430519..2430671 | ||||
| ribD | ribG | - | 2429452..2430537 | riboflavin-specific deaminase | COG1985 | ribD-STA ribG-BAC ribG-BAC |
| ribE | ribB | - | 2428794..2429441 | riboflavin synthase (alpha subunit) | COG0307 | |
| ribA | - | 2427583..2428779 | GTP cyclohydrolase II and 3,4-dihydroxy-2-butanone 4-phosphate synthase | COG0807 | ribA-BAC ribA-STA | |
| ribH | - | 2427086..2427550 | riboflavin synthase (beta subunit) | COG0054 | ribH-BAC-1 ribH-BAC-2 ribH-STA | |
| ribT | ribD | - | 2426599..2426973 | reductase | ribD-STA ribG-BAC |
| Operon evidence: | Northern blotting (4.3 kb transcript); nuclease protection mapping of the 5' and 3' end |
|---|---|
| Reference: | Mironov VN, et al. (1990), Azevedo V, et al. (1993), Mironov VN, et al. (1994), Perkins JB, et al., Mironov AS, et al. (2002), Genbank L09228 |
| Comments: | The 3' end of the mRNA was mapped 47 bp downstream of ribT in a T-rich region. Internal promoters in front of ribA and ribT, leading to a 2.4 kb and a 0.4 kb transcript. The original papers do not mention the existence of the ypuE gene, which partly overlaps ribD. The promoter site that was found experimentally for ribD lies upstream of ypuE. Azevedo also finds a 0.16 kb ypuE-specific transcript. Just upstream of ribD is a putative terminator/antiterminator structure. Binding of flavin mononucleotide or flavin adenine dinucleotide to the rfn (riboflavin) box favor transcriptional termination. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -43:+9 | 2430822..2430873 | TATTTCATTGCGTACTTTAAAAAGGATCGCTATAATAACCAATAAGGACAAA |
Mironov VN, et al. (1994): NB S1 Perkins JB, et al. (1999): RG NB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAATACCTAAAGCCCCGAATTTTTTATAAATTCGGGGCTTTTTTGACGGTAAA >>>>>>>>>>> <<<<<<<<<<< |
ypuE | |||
| ATTAAGCAGAGGCTGTGATCAGTCTCTGCTTTTTTTTCTGCGTT >>>>>>>>>> <<<<<<<<<< |
ribT |
|