| Regulated Operon: | ypzA | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ypzA | + | 2307692..2307961 | 
| Operon evidence: | upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | |
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigG | Promoter | -38:+16 | 2307641..2307694 | GGTACATAAATTTCAAAAAAACTCTGCAAAATAATGGCGGAGGTGTTTTTTGTG | Wang S, et al. (2006): AR, Race-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TCAAAGAATAAAAACCGCAGCTTCTGCGGTTTTTATTTTTAGTG >>>>>> <<<<<< | ypzA | 


| 
 |