| Regulated Operon: | yqfSU | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yqfS | nfo | - | 2592514..2593407 | COG0648 | ||
| yqfU | - | 2591236..2592117 | COG1284 | x0569-BAC yqfU-BAC | 
| Operon evidence: | Northern blotting (2.3 kb transcript) | 
|---|---|
| Reference: | Urtiz-Estrada N, et al. (2003) | 
| Comments: | The gene yqfT is located between yqfS and yqfU, but is transcribed in the opposite direction. | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigG | Promoter | -40:+5 | 2593458..2593502 | AGCCTGGGTATAAAAAGAAAATGAGCTATGAGATGGAGAAAATCA | Urtiz-Estrada N, et al. (2003): PE NB RT-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| GAAAATGGCTTGCTGGACAGACAGCTGCCATTTTCTTTTTCATAC >>>>>>>>>> <<<<<<<<< | yqfU | 


| 
 |