| Regulated Operon: | yqhB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yqhB | + | 2560818..2562146 | COG1253 | x0520-BAC-3 |
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Au N, et al. (2005) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| LexA | Negative | ND | 2560683..2560706 | TCCTCCAAACTTTTGTTCTTTATT |
Au N, et al. (2005): GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCTGTTCAGCTGCTATCTTTCAAGATAAACATGGCAAAGGCATCAACACTCTTTTATTTTAAACCC >>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<< |
yqhB |


|