| Regulated Operon: | yqhB | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yqhB | + | 2560818..2562146 | COG1253 | x0520-BAC-3 | 
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | Au N, et al. (2005) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| LexA | Negative | ND | 2560683..2560706 | TCCTCCAAACTTTTGTTCTTTATT | Au N, et al. (2005): GS | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| GCTGTTCAGCTGCTATCTTTCAAGATAAACATGGCAAAGGCATCAACACTCTTTTATTTTAAACCC >>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<< | yqhB | 


| 
 |