| Regulated Operon: | yrrD | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yrrD | - | 2804931..2805455 | COG3881 | 
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand. | 
|---|---|
| Reference: | Wang S, et al. (2006) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigG | Promoter | -39:+15 | 2805408..2805461 | CATCGTATGAGTCTAAGGCGCAAAGCAAAACCTAAGCCTGTTCAACAAAAGGTG | Wang S, et al. (2006): AR, Race-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TTTAATGCAAAAAGGATACTCTCCAAAGAGTATCCTTTTCTATGTTTGCC >>>>>>>>> <<<<<<<<< | yrrD | 


| 
 |