| Regulated Operon: | yrrRS | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yrrR | pbpI | - | 2788913..2790667 | COG0768 | ||
| yrrS | - | 2788147..2788848 | 
| Operon evidence: | Genome analysis; SigE drives transcription of both yrrR and yrrS. | 
|---|---|
| Reference: | |
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | ND | ND | ND | Wei Y, et al. (2004): RG DB | 
| SigF | Promoter | -39:+16 | 2790665..2790719 | ATCTGTTTAGCAGCGAAACACCTCGTCCACAATGTGGGTGAGGTGTTTTTTTATG | Wang S, et al. (2006): AR, Race-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| ATAAACAAAAGCAGCCGGGTTAAAACCGGCTGCTTTTGTTTTAGGCTT >>>>>>>> <<<<<<<< | yrrS | 


| 
 |