| Regulated Operon: | ysdB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ysdB | + | 2950564..2950956 |
| Operon evidence: | upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Huang X, et al. (1999), Wipat A, et al. (1996) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigW | Promoter | -39:+4 | 2950493..2950535 | AAAAGTGAAACCTTTTTCTATGCTTTTCGTATTACATCAGATC |
Huang X, et al. (1999): S1 Cao M, et al. (2002): AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAGAGCGTTAAACGCTTTTCTGCTTTTTAT >>>> <<<< |
ysdB |


|