| Regulated Operon: | ysdB | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ysdB | + | 2950564..2950956 | 
| Operon evidence: | upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | Huang X, et al. (1999), Wipat A, et al. (1996) | 
| Comments: | 
| Binding factor  | 
  Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigW | Promoter | -39:+4 | 2950493..2950535 | AAAAGTGAAACCTTTTTCTATGCTTTTCGTATTACATCAGATC | 
  Huang X, et al. (1999): S1 Cao M, et al. (2002): AR  | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| GAAGAGCGTTAAACGCTTTTCTGCTTTTTAT >>>> <<<<  | 
  ysdB | 


  |