| Regulated Operon: | ysnF | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ysnF | + | 2897995..2898855 | 
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand | 
|---|---|
| Reference: | Wipat A, et al. (1996) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | ND | ND | ND | Pragai Z, et al. (2002): RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAACCTCAAATCCTAAATGGATTTGAGGTTTTTCTTTTGGTAC >>>>>>>>>> <<<<<<<<<< | ysnF | 


| 
 |