| Regulated Operon: | yteV |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yteV | cse60 | - | 3077440..3077622 |
| Operon evidence: | downstream genes are in the opposite direction |
|---|---|
| Reference: | Henriques AO, et al. (1997) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -37:+7 | 3077636..3077679 | TCTATCATAACGCTGTTCCAAACGGAATAGATTGATAGAGAAAG |
Henriques AO, et al. (1997): PE HM OV DB RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGATCTTTCCGCAGGCGCGGAAAGATCTTTTTTGTTAATATG >>>>>>>>>>> <<<<<<<<<<< |
yteV |


|