| Regulated Operon: | ytkL | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ytkL | - | 3008954..3009637 | 
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | Lapidus A, et al. (1997), Genbank AF008220 | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | ND | 3009662..3009703 | ATAAGTTTTTCAGCTTTTTAAAAAGGGAAAATAAAAAAAACA | Petersohn A, et al. (1999): HB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TGAAACCATCTCCTGATGAATCAGGAGGTGGTTTTTATTTTTTCAG >>>>>>>>>>> <<<<<<<<<<< | ytkL | 


| 
 |