 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ytrHI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ytrH | + | 2993795..2994136 | ||||
| ytrI | + | 2994133..2994636 |
| Operon evidence: | 5' RACE-PCR of the downstream ytrI gene; gene downstream of ytrI is on the opposite strand |
|---|---|
| Reference: | Eichenberger P, et al. (2003) |
| Comments: | ytrH gene was discovered by Patrick Eichenberger |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -35:+12 | 2993741..2993787 | ATCATCATACTTGTCCTGAAAGCTCAATATGATATAAAAGGTGAGGT |
Eichenberger P, et al. (2003): AR, 5'-RACE-PCR |
|