| Regulated Operon: | yttA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yttA | + | 3107669..3108409 |
| Operon evidence: | Northern blotting (0.7 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2003), Lapidus A, et al. (1997), Genbank AF008220 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TnrA | Negative | ND | 3107600..3107616 | CGTGAAAAAATCTAACA |
Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCTCCAGAATGTCTGGAGCTTTTTCTGTTTCACA >>>>>>>> <<<<<<<< |
yttA |


|