| Regulated Operon: | yunB | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yunB | - | 3321489..3322253 | 
| Operon evidence: | downstream gene is in the opposite direction | 
|---|---|
| Reference: | Eichenberger P, et al. (2003) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -38:+11 | 3322261..3322309 | CTATTACTATGTCCCCTCTTACAAGCATACATTGTGATATGTAAGGGGG | Eichenberger P, et al. (2003): AR, 5'-RACE-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AATAAGCCGCCTGTTGAAGAGGCGGCTTTTTGTTACTTCTT >>>>>>> <<<<<<< | yunB | 


| 
 |