 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ywaC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ywaC | ipa-7d | - | 3948973..3949605 | COG2357 |
| Operon evidence: | downstream genes are on the opposite strand |
|---|---|
| Reference: | Cao M, et al. (2002), Presecan E, et al. (1997) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigW | Promoter | -39:+3 | 3949642..3949683 | ATTCATAGAACCTTGCAGCAGACAGGGACGTCTAGTACATGG |
Cao M, et al. (2002): ROMA AR RG PE RO |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGACGGCACCCAAGTGCCGTCTTTTTTTATTTGATA >>>>>>>> <<<<<<<< |
ywaC |
|