| Regulated Operon: | ywdL | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ywdL | ipa-62r, gerQ | + | 3892458..3893003 | 
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | Presecan E, et al. (1997) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -46:+7 | 3892296..3892348 | GTTCTTTTTCAGCATAATCCAAGCATCAGCCTCATAAGGTGAAAGAGATAAAA | Ragkousi K, et al. (2003): PE RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAAGCCAATCACTCATATGATGAGGATTGGCTTTTTTGTTTATAGA >>>>>>>>>>>>> <<<<<<<<<<<< | ywdL | 


| 
 |