| Regulated Operon: | ywhE | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ywhE | pbpG | + | 3848841..3850784 | COG0744 | 
| Operon evidence: | upstream and downstream genes are transcribed in the opposite direction | 
|---|---|
| Reference: | |
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigF | Promoter | -42:+4 | 3848772..3848817 | TTCTGCGATGTTTAAAAACGATCTTTTTTTCTCATAATAGTAGAAA | Pedersen LB, et al. (2000): RG PE | 
| SigG | Promoter | -42:+4 | 3848772..3848817 | TTCTGCGATGTTTAAAAACGATCTTTTTTTCTCATAATAGTAGAAA | Pedersen LB, et al. (2000): RG PE | 


| 
 |