| Regulated Operon: | ywjC | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ywjC | + | 3817929..3818201 | 
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand | 
|---|---|
| Reference: | Presecan E, et al. (1997), Genbank Z49782 | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | -44:+8 | 3817855..3817906 | AAAAATAGGTTTACGACTTGTCAGCTTTGGGAACTTAGGCTATATAAGACAA | Price CW, et al. (2001): RACE-PCR DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAAGGATAGACATCTGTCTATCCTTTTTCTTATGCTCT >>>>>>>> <<<<<<<< | ywjC | 


| 
 |