| Regulated Operon: | ywpH-glcR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ywpH | - | 3739233..3739574 | COG0629 | |||
| glcR | ywpI | - | 3738233..3739009 | transcriptional regulator (DeoR family) | COG1349 |
| Operon evidence: | Northern blotting (1.4 kb transcript) |
|---|---|
| Reference: | Lindner C, et al. (2004) |
| Comments: | A longer transcript of 2.4 kb was assumed to be due to readthrough into the downstream ywpJ gene. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | ND | 3739714..3739737 | AAAAGTACATATTTCTTCAAAGGA |
Ogura M, et al. (2002): AR RG HM DB |
| ComK | Positive | ND | 3739694..3739714 | AAAAAAGCAAAAGATGTTTTT |
Ogura M, et al. (2002): AR RG HM DB |


|