| Regulated Operon: | ywrD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ywrD | - | 3718161..3719738 | COG0405 |
| Operon evidence: | Northern blotting (2.0 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2003) |
| Comments: | This terminator is located after the downstream gene ywrE, which is transcribed in the opposite direction. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TnrA | Positive | ND | 3719805..3719821 | CGTCAGTTTTTCTGCCG |
Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAAGAACACCCCGAGCTTGCTCTGGGTGTTCTTTTTTTTGATATTT >>>>>>>>>>>> <<<<<<<<<<<< |
ywrD |


|