 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ywrJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ywrJ | - | 3713029..3713706 |
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997), Genbank Z93767 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigK | Promoter | ND | ND | ND |
Kuwana R, et al. (2002): SDS-PAGE, RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAAAACTGCCCTCTTGAAAAGCAGAAGGCAGTTTTTCGTTTCATAC >>>>>>>>>>> <<<<<<<<<< |
ywrJ |
|