| Regulated Operon: | yxbCD | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yxbC | yxaQ | - | 4094935..4095927 | COG2850 | ||
| yxbD | yxaR | - | 4094376..4094855 | COG0454 | 
| Operon evidence: | Northern blotting (2.3 kb transcript); downstream gene is on the opposite strand | 
|---|---|
| Reference: | Yoshida K, et al. (2000) | 
| Comments: | A readthrough terminator may exist downstream of yxbC, leading to a 1.1 kb transcript. | 
  
| Binding factor  | 
  Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| AbrB | Negative | ND | ND | ND | 
  Hamon MA, et al. (2004): AR RT-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| TAAAAGGCGCTCCTCTAAGGAAGCGCCTTTTGATCATGCGAT >>>>>>>>> <<<<<<<<<<  | 
  yxbD | 


  |