 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yxbCD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yxbC | yxaQ | - | 4094935..4095927 | COG2850 | ||
| yxbD | yxaR | - | 4094376..4094855 | COG0454 |
| Operon evidence: | Northern blotting (2.3 kb transcript); downstream gene is on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: | A readthrough terminator may exist downstream of yxbC, leading to a 1.1 kb transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AbrB | Negative | ND | ND | ND |
Hamon MA, et al. (2004): AR RT-PCR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAAGGCGCTCCTCTAAGGAAGCGCCTTTTGATCATGCGAT >>>>>>>>> <<<<<<<<<< |
yxbD |
|