 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yxkF-msmX |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yxkF | - | 3984370..3985263 | COG2508 | |||
| msmX | yxkG | - | 3983152..3984249 | multiple sugar-binding transport ATP-binding protein | COG3839 | msmX-BAC |
| Operon evidence: | Northern blotting (2.3 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2000), BSORF |
| Comments: | An internal promoter in front of msmX leads to a 1.3 kb transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CcpA | Negative | ND | 3984265..3984287 | TATAAGAAAGCGTTTACAATAAC |
Miwa Y, et al. (2000): RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCGGACATGGAGACATGTCCGGTTTTTTGCTATTGAA >>>>>>>>> <<<<<<<<< |
msmX |
|