| Regulated Operon: | yxkO | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yxkO | - | 3971467..3972297 | COG0063 | 
| Operon evidence: | Northern blotting (1.0 kb transcript); downstream gene is on the opposite strand | 
|---|---|
| Reference: | Yoshida K, et al. (2000) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | ND | 3972317..3972358 | TTTTGTTTGAAAAAGAAAAGGGACAGGAAAAATAGGAAAAGA | Petersohn A, et al. (1999): HB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAAGCTGTCTTCAGAGAGAAGACAGCTTTTCTTGATACCCC >>>>>>>>> <<<<<<<<< | yxkO | 


| 
 |