| Regulated Operon: | yyaF-rpsF-ssb-rpsR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yyaF | - | 4198867..4199967 | COG0012 | x0048-BAC | ||
| rpsF | - | 4198469..4198756 | ribosomal protein S6 (BS9) | COG0360 | rpsF-STA rpsF-STR | |
| ssb | - | 4197910..4198428 | single-strand DNA-binding protein | COG0629 | ssb-BAC-1 ssb-BAC-2 ssb-OYP ssb-STA ssb-STR x1145-LAB | |
| rpsR | - | 4197627..4197866 | ribosomal protein S18 | rpsR-BAC rpsR-LAB rpsR-STA rpsR-STR |
| Operon evidence: | Northern blotting (2.4 kb transcript) |
|---|---|
| Reference: | Lindner C, et al. (2004) |
| Comments: | Internal promoter in front of rpsF, leading to a 1.2 kb transcript. Northern blotting results in BSORF also show a yyaDEF-rpsF-ssb-rpsR transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | ND | 4200078..4200094 | ATCAAAGGGATTGGCAA |
Ogura M, et al. (2002): AR RG HM DB |
| ComK | Positive | ND | 4200061..4200078 | AGCTGAAAATGCTTTTTT |
Ogura M, et al. (2002): AR RG HM DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GTAAAGAGCAAGGACCTTCGGGTTCTTGCTCTTTTTTATAGGGGGG >>>>>>>>>>> <<<<<<<<<<< |
rpsR |


|