| Regulated Operon: | yycCB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yycC | + | 4158601..4158741 | ||||
| yycB | + | 4158814..4160022 | COG2807 |
| Operon evidence: | Northern blotting (1.4 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2003) |
| Comments: | Northern blotting results in BSORF show a yycB-yycA transcript and a monocistronic yycB transcript |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TnrA | Negative | ND | 4158535..4158551 | TGTGACATCTTCTTACA |
Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATAAAGCGGGGAAGATATCTCCGCTTTTTTCTTTGAATA >>>>>>> <<<<<<< |
yycB |


|