| Factor type | ND |
|---|---|
| SWISS-PROT | P39075 |
| SubtiList | BG10304 |
| Consensus seq. | ND |
| Comment | a similar factor, BltR, regulates another multidrug transporter operon, Blt; the binding activity is enhanced by rhodamine and tetraphenylphosphonium (TPP) |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| bmrU-bmr-bmrR | bmr | SigA | Positive | 2493782..2493812 | -37:-7 | TTGACTCTCCCCTAGGAGGAGGTCTTACAGT |
Ahmed M, et al. (1994): DB GS FT |
|