 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | two-component response regulator |
|---|---|
| SWISS-PROT | O34534 |
| SubtiList | BG12577 |
| Consensus seq. | WWCAAA where W = A|T |
| Comment | involved in the response to the environmental Mg-citrate complex (positive regulation of citM) |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| citM-yflN | citM | SigA | Positive | 833564..833614 | -36:-85 | ATCAAAAAGAACAAAACGGTTTTAAAAAATTAAAAATACAAAAAAACCAAA |
Yamamoto H, et al. (2000): NB FT |
| citM-yflN | citM | SigA | Positive | 833453..833482 | -196:-168 | AACAGCAGGGAAACGAAACGGTTTTTAGAA |
Yamamoto H, et al. (2000): NB FT |
|