| Factor type | NifA/NtrC |
|---|---|
| SWISS-PROT | P23914 |
| SubtiList | BG10677 |
| Consensus seq. | ND |
| Comment | Activator which regulates the neighboring operon. Note that -144:-130 and -108:-120 makes a palindromic structure |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| levDEFG-sacC | levD | SigL | Positive | 2762193..2762235 | -148:-106 | TATGAACCTGTATTAAATGGAACACCATTTTAATACAGGTTTA |
Debarbouille M, et al. (1991): DB RG Martin-Verstraete I, et al. (1994): DP DB GS FT |
| levDEFG-sacC | levD | SigL | Positive | 2762156..2762179 | -92:-69 | AAGTGTTTCAACAACAAATTGCTA |
Debarbouille M, et al. (1991): DB RG Martin-Verstraete I, et al. (1994): DP SDM GS FT |
|