Regulated Operon: | levDEFG-sacC |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
levD | sacL | - | 2761620..2762060 | phosphotransferase system (PTS) fructose-specific enzyme IIA component | COG2893 | |
levE | sacL | - | 2761132..2761620 | phosphotransferase system (PTS) fructose-specific enzyme IIB component | COG3444 | |
levF | sacL | - | 2760306..2761115 | phosphotransferase system (PTS) fructose-specific enzyme IIC component | COG3715 | |
levG | sacL | - | 2759458..2760285 | phosphotransferase system (PTS) fructose-specific enzyme IID component | COG3716 | |
sacC | sacL | - | 2757268..2759301 | levanase | COG1621 |
Operon evidence: | 5' primer extension mapping of the sacC gene |
---|---|
Reference: | Martin I, et al. (1989), Martin I, et al. (1987) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
CcpA | Negative | -50:-36 | 2762125..2762139 | TGAAAACGCTTAACA |
Martin-Verstraete I, et al. (1995): SDM DB |
LevR | Positive | -148:-106 | 2762193..2762235 | TATGAACCTGTATTAAATGGAACACCATTTTAATACAGGTTTA |
Debarbouille M, et al. (1991): DB RG Martin-Verstraete I, et al. (1994): DP DB GS FT |
LevR | Positive | -92:-69 | 2762156..2762179 | AAGTGTTTCAACAACAAATTGCTA |
Debarbouille M, et al. (1991): DB RG Martin-Verstraete I, et al. (1994): DP SDM GS FT |
SigL | Promoter | -35:+5 | 2762083..2762122 | ACTGTGTTGGCACGATCCTTGCATTATATATGGATGTACA |
Martin I, et al. (1989): PE Debarbouille M, et al. (1991): DB RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGGCACAGACCCGAACAGTCTGTGCCTTCTTGTTATTTTAA >>>>>>>>> <<<<<<<<< |
sacC |
|