 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | MerR family |
|---|---|
| SWISS-PROT | P71039 |
| SubtiList | BG12482 |
| Consensus seq. | ND |
| Comment | The N-terminal domain of Mta(MtaN) acts as a constitutive activator of the transcription of bmr and blt genes. |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| blt-bltD | blt | SigA | Positive | 2716095..2716116 | -35:-14 | GACTATACGGTAACCATATACC |
Baranova NN, et al. (1999): NB FT |
| bmrU-bmr-bmrR | bmr | SigA | Positive | 2493784..2493805 | -35:-14 | GACTCTCCCCTAGGAGGAGGTC |
Baranova NN, et al. (1999): NB FT |
| mta | mta | SigA | Positive | 3763956..3763978 | -35:-13 | GACCCTAACGTTGCGTGATTGTT |
Baranova NN, et al. (1999): NB FT |
| ydfK | ydfK | SigA | Positive | ND | ND | ND |
Baranova NN, et al. (1999): NB |
|