| Factor type | NtrC/NifA |
|---|---|
| SWISS-PROT | P38022 |
| SubtiList | BG10723 |
| Consensus seq. | GCAAAATAATTTTGCA(T/C)T |
| Comment | NtrC/NifA transcriptional activator (cf. LevR). Sigma 54-dependent activators generally bind two inverted repeat sequences called UAS, which are located approx. 100bp upstream from the -12/-24 promoters. DNA bending is used for activation (AhrC may be involved). Inducible by ornithine or citrulline? At least upstream UAS1 is the target of RocR |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| rocABC | rocA | SigL | Positive | 3879729..3879752 | -217:-194 | CCTCCGCAAAATAATTTTGCATTT |
Ali NO, et al. (2003): FT DP Calogero S, et al. (1994): DB |
| rocABC | rocA | SigL | Positive | 3879680..3879708 | -173:-145 | AAAACGCAAAATAAATTTGCGTTCAAGAT |
Ali NO, et al. (2003): FT DP Calogero S, et al. (1994): DB |
| rocDEF | rocD | SigL | Positive | 4144687..4144707 | -130:-110 | TATGCAAAAGAATTTTGCACT |
Gardan R, et al. (1995): DP RG HM |
| rocDEF | rocD | SigL | Positive | 4144646..4144666 | -89:-69 | ATATCAGAATGTTTTTGCACC |
Gardan R, et al. (1995): DP HM |
| rocG | rocG | SigL | Positive | 3879729..3879752 | downstream of rocG | CCTCCGCAAAATAATTTTGCATTT |
Belitsky BR & Sonenshein AL (1999): RG DP Ali NO, et al. (2003): FT DP |
| rocG | rocG | SigL | Positive | 3879680..3879708 | downstream of rocG | AAAACGCAAAATAAATTTGCGTTCAAGAT |
Belitsky BR & Sonenshein AL (1999): RG DP Ali NO, et al. (2003): FT DP |
| rocR | rocR | SigA | Negative | 4144687..4144707 | -50:-30 | AGTGCAAAATTCTTTTGCATA |
Gardan R, et al. (1995): DB PE RG |
|