Transcription factor: RocR

Factor type NtrC/NifA
SWISS-PROT P38022
SubtiList BG10723
Consensus seq. GCAAAATAATTTTGCA(T/C)T
Comment NtrC/NifA transcriptional activator (cf. LevR). Sigma 54-dependent activators generally bind two inverted repeat sequences called UAS, which are located approx. 100bp upstream from the -12/-24 promoters. DNA bending is used for activation (AhrC may be involved). Inducible by ornithine or citrulline? At least upstream UAS1 is the target of RocR
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
rocABC rocA SigL Positive 3879729..3879752 -217:-194 CCTCCGCAAAATAATTTTGCATTT Ali NO, et al. (2003): FT DP
Calogero S, et al. (1994): DB
rocABC rocA SigL Positive 3879680..3879708 -173:-145 AAAACGCAAAATAAATTTGCGTTCAAGAT Ali NO, et al. (2003): FT DP
Calogero S, et al. (1994): DB
rocDEF rocD SigL Positive 4144687..4144707 -130:-110 TATGCAAAAGAATTTTGCACT Gardan R, et al. (1995): DP RG HM
rocDEF rocD SigL Positive 4144646..4144666 -89:-69 ATATCAGAATGTTTTTGCACC Gardan R, et al. (1995): DP HM
rocG rocG SigL Positive 3879729..3879752 downstream of rocG CCTCCGCAAAATAATTTTGCATTT Belitsky BR & Sonenshein AL (1999): RG DP
Ali NO, et al. (2003): FT DP
rocG rocG SigL Positive 3879680..3879708 downstream of rocG AAAACGCAAAATAAATTTGCGTTCAAGAT Belitsky BR & Sonenshein AL (1999): RG DP
Ali NO, et al. (2003): FT DP
rocR rocR SigA Negative 4144687..4144707 -50:-30 AGTGCAAAATTCTTTTGCATA Gardan R, et al. (1995): DB PE RG




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai