 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | rocDEF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| rocD | - | 4143325..4144530 | ornithine aminotransferase | COG4992 | rocD-BAC-1 rocD-BAC-2 rocD-STA | |
| rocE | - | 4141699..4143102 | amino acid permease | COG0833 | x0901-BAC-1 x0901-BAC-2 | |
| rocF | - | 4140735..4141625 | arginase | COG0010 | rocF-BAC |
| Operon evidence: | translational fusion with lacZ; Northern blotting |
|---|---|
| Reference: | Gardan R, et al. (1995), BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AhrC | Positive | -18:+1 | 4144577..4144595 | CTTGCATTTATATAAAGGG |
Miller CM, et al. (1997): GS FT |
| RocR | Positive | -130:-110 | 4144687..4144707 | TATGCAAAAGAATTTTGCACT |
Gardan R, et al. (1995): DP RG HM |
| RocR | Positive | -89:-69 | 4144646..4144666 | ATATCAGAATGTTTTTGCACC |
Gardan R, et al. (1995): DP HM |
| SigL | Promoter | -35:+5 | 4144573..4144612 | CTTGATTTGGCACAGAACTTGCATTTATATAAAGGGAAAG |
Gardan R, et al. (1995): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAACCCCCGCACCCGCGGGTTTTCAGCGTGTCGA >>>>> <<<<< |
rocF |
|