 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | ND |
|---|---|
| SWISS-PROT | O31654 |
| SubtiList | BG13269 |
| Consensus seq. | ND |
| Comment | temperature-sensitive growth in a null mutant; transcription induced by heat shock in rich medium but not in minimal medium; reduced amount of GsiB protein in a sigI mutant under heat shock conditions |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| sigI-rsgI | sigI | 1411037..1411090 | -47:+7 | CGCATAAAACCCCCTTAATTCTTTAGAAAGGCACGAAATCATGTATAGAACGTC |
Zuber U, et al. (2001): DB PE Asai K, et al. (2007): DB RG PE DP NB |
|