 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | GntR |
|---|---|
| SWISS-PROT | P39796 |
| SubtiList | BG11011 |
| Consensus seq. | ND |
| Comment | repressor of the Tre operon which contains at least treP and treA; treR is located downstream of treA. Binding sites are palindromes. Trehalose-6-phosphate probably acts as an inducer. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| trePAR | treP | SigA | Negative | 849619..849652 | -38:-5 | GTGTTGACTACCTGTATATACAGGAATACAATAT |
Schock F & Dahl MK (1996): DB GS HB |
| trePAR | treP | SigA | Negative | 849652..849683 | +6:+17 | TGATTATAAGTTGTATATACAAGTTATAAAAA |
Schock F & Dahl MK (1996): DB GS HB |
|