 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | trePAR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| treP | treB | + | 849703..851115 | phosphotransferase system (PTS) trehalose-specific enzyme IIBC component | COG1264 | treB-BAC |
| treA | treC | + | 851186..852871 | trehalose-6-phosphate hydrolase | COG0366 | treC-BAC |
| treR | yfxA | + | 852892..853608 | transcriptional regulator (GntR family) | COG2188 | treR-BAC |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | Schock F & Dahl MK (1996), Schock F & Dahl MK (1996), BSORF |
| Comments: | Schock measured a trePA (3.2 kb) and a trePAR (more than 4 kb; weak) transcript. The short transcript was hybridized to a treA probe only; it was identified as a trePA transcript based on its length. Northern blotting results in BSORF show a trePAR, a treAR, and a treR transcript. The terminator proposed by Schock lacks a T-stretch. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CcpA | Negative | +362:+384 | 850018..850040 | GCTGTGAAAACGCTTGCAGATAT |
Miwa Y, et al. (2000): RG |
| SigA | Promoter | -38:+4 | 849619..849660 | GTGTTGACTACCTGTATATACAGGAATACAATATGATTATAA |
Schock F & Dahl MK (1996): PE |
| TreR | Negative | -38:-5 | 849619..849652 | GTGTTGACTACCTGTATATACAGGAATACAATAT |
Schock F & Dahl MK (1996): DB GS HB |
| TreR | Negative | +6:+17 | 849652..849683 | TGATTATAAGTTGTATATACAAGTTATAAAAA |
Schock F & Dahl MK (1996): DB GS HB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAGAGGCGCCTGCCTGCGGCAGCGCGCTTTTTTGTTTGGTAT >>>>>>>>> <<<<<<<<<< |
treR |
|