Transcription factor: TrnB-Gly1

Factor type transfer RNA
SWISS-PROT P39118
SubtiList BG00078
Consensus seq. aANNaGGGTGGtACCgCG
Comment Uncharged tRNA-Gly binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
glyQS glyQ None Positive 2607979..2608004 None GCAACTAGGGTGGAACCGCGGGAGAA Grundy FJ, et al. (2002): RO RG SDM
Yousef MR, et al. (2005): Size-exclusion filtration




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai