Regulated Operon: | glyQS |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
glyQ | yqfJ | - | 2606995..2607882 | glycyl-tRNA synthetase (alpha subunit) | COG0752 | glyQ-BAC glyQ-LAB glyQ-STR |
glyS | yqfK | - | 2604963..2607002 | glycyl-tRNA synthetase (beta subunit) | COG0751 | x0027-CLO |
Operon evidence: | Genome analysis |
---|---|
Reference: | |
Comments: | Transcriptional readthrough occurs at the stem-loop upstream of glyQ if uncharged glycine tRNA binds to the T-box motif in the nascent mRNA transcript. The tRNA anticodon binds to the GGC codon in the sequence AAAGGCAUU in the glyQ leader mRNA. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
TrnB-Gly1 | Positive | ND | 2607979..2608004 | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
TrnD-Gly | Positive | ND | 2607979..2608004 | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
TrnI-Gly | Positive | ND | 2607979..2608004 | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
TrnJ-Gly | Positive | ND | 2607979..2608004 | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CGCGGGAGAACTCTCGTCCCTATGTTTGCGGCTGGCAAGCATAGAGACGGGAGTTTTTTGGTTGCTGC >>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<< |
glyQ |
|