 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | transfer RNA |
|---|---|
| SWISS-PROT | P37477 |
| SubtiList | BG00024 |
| Consensus seq. | aANNaGGGTGGtACCgCG |
| Comment | Uncharged tRNA-Gly binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| glyQS | glyQ | None | Positive | 2607979..2608004 | None | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
|