 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | Xre |
|---|---|
| SWISS-PROT | P23789 |
| SubtiList | BG10994 |
| Consensus seq. | ND |
| Comment | repressor of a phage-like bacteriocin, PBSX (phibacin damaged-prophage). Helix-turn-helix protein. Acts at the operator-promoter region. |
| Link to | Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| xkdBCD-xtrA | xkdB | None | Negative | 1321082..1321105 | None | GATGATACAGAATGTATCGTTTAT |
McDonnell GE, et al. (1994): GS FT |
| xkdBCD-xtrA | xkdB | None | Negative | 1321115..1321142 | None | CATCCGATACAAAATGTATCAAAAAAGA |
McDonnell GE, et al. (1994): GS FT |
| xre | xre | None | Negative | 1321023..1321047 | None | ATTTTGATACATTTTGTATCTATAA |
McDonnell GE, et al. (1994): GS FT |
| xre | xre | None | Negative | 1321049..1321076 | None | ATTTTTGATACTTTTTTTATCATAACTT |
McDonnell GE, et al. (1994): GS FT |
|