 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | ND |
|---|---|
| SWISS-PROT | P40758 |
| SubtiList | BG10871 |
| Consensus seq. | possible motif: repeated TTTTGT |
| Comment | The GlnK-GlnL (formerly YcbA-YcbB) two-component system positively regulates the expression of the glsA-glnT (formerly ybgJ-ybgH) operon in response to glutamine in the culture medium on Northern analysis. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| ybgJ-ybgH | ybgJ | SigA | Positive | 265272..265315 | -56:-13 | CAAAATGTTTTTGTCGTATTTTGTATGATTCTGTAGTCTCCATT |
Satomura T, et al. (2005): GS FT |
|